sindy35111 sindy35111
  • 03-09-2018
  • Mathematics
contestada

Please Please help it would be greatly appreciated!! :)

Please Please help it would be greatly appreciated class=

Respuesta :

ralphwx1 ralphwx1
  • 03-09-2018
13. Collinear means the three points lie on a line. For instance, A, C, and E are collinear.
14. A, C, and D do not lie on the same line, so they are not collinear.
15. Coplanar means the four points are in the same plane. For example, B, C, D, and F lie in the same plane and are coplanar.
16. Yes, the hash marks indicate the lengths are equal.
17. No, there is no evidence the lines are equal in length.
Answer Link

Otras preguntas

A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Solve the equation -10 + 3x + 5x = -56 ? ??
Why did the American public mostly oppose joining the League of Nations after WWI?
the bombing of Hiroshima and Nagasaki resulted in
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
31+34=90-n 45+1=70-k 6×9=41+m
a antonym for biosphere
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5