baeethtsadia baeethtsadia

04-02-2019
Mathematics

contestada

what is the area of the trapezoid shown ?

what is the area of the trapezoid shown class=

Respuesta :

mathecoach mathecoach

04-02-2019

Answer:

A = 1/2 * (a + c) * h

A = 1/2 * (6 + (2 + 6 + 2)) * 6 = 48

Answer Link

Otras preguntas

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

How did new industrial technologies influence the course of world war i?

When a circular pizza is cut into six slices using diameters, the total length of the cuts is 18 cm. what is the area of the pizza in square centimeters?

A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil

stars and planets are made from gases in a

With this sole proprietorship, who pays the taxes?

The exodus of medical professionals from africa to europe is an example of brain drain as it has the potential to __________.

Which phrase is NOT a way to state the meaning of the expression x – 3? The difference of a number and 3 A number minus 3 A number subtracted from 3 3 less than

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Solving this question