Theav2004
Theav2004 Theav2004
  • 01-03-2020
  • History
contestada

Will humans ever walk on the sun?

Respuesta :

XxCakeKingxX
XxCakeKingxX XxCakeKingxX
  • 01-03-2020

No because we have not made gear to sustain such harsh temperatures and never will.

Answer Link

Otras preguntas

Sean used 1-3/4 cup of sugar to make a dozen brownies. How many cups of sugare are used for 6 dozen brownies? a 6-3/4 b 10-2/4 c 42/4 d 10-1/2
Where can you find cells that each have a cell well, a nucleus, and chloroplasts? A. There cells cannot be found. B. In plants C. In animals D. In both plants a
What is a common noun of George Washington
You draw one card from a 52 card deck then the card is replaced and the deck the deck is shuffled and your draw again find a the probability of drawing a red ca
What is an astronomical unit or AU?
Modern whales appreared 5-10 million years ago. The vertebrae off a whale discovered by paleontologists contain roughly 0.25% as much carbon-14 as they would ha
When 3g ^2- 4g+ 2 is subtracted from 7g^2+ 5g- 1, the difference is
what is best android apps​
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
a television and DVD player cost a total of 976. The cost of the television is three times the cost of the DVD player. Find the cost of each item