melodyt732 melodyt732

03-11-2016
Physics

contestada

Which of the following statements best explains why a book resting on a table is in equilibrium?

Respuesta :

jasminekskyeem jasminekskyeem

03-11-2016

The net force equals zero there is no friction involved only gravity and a normal force acts on it

Answer Link

Otras preguntas

Which of the following are considered irregular verbs? Poner and lavar Poner and hacer Bañar and poner Lavar and hacer

In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?

What did president wilson's wife make sure was on the white house lawn?

20 POINTS - MONOHYBRID CROSS Complete the following monohybrid cross. Two parents that are heterozygous for brown eyes. Be sure to identify the genotypes of t

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis

The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is

Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.

PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!

what is the most important factor that holds a gene pool of a species together and prevents speciation?