omarpadilla119 omarpadilla119
  • 03-03-2021
  • Mathematics
contestada

I need help with this ​

I need help with this class=

Respuesta :

morrisonlexa123
morrisonlexa123 morrisonlexa123
  • 03-03-2021

Answer:

I'm not sure good luck though

Answer Link

Otras preguntas

I need help please Question 9 Help for my homework
Dan’s income can be calculated as $20 times the number of hours worked (h) added to his overtime wages of $300. If you subtract $600 to pay a bill, his income t
You travel 5 hours and 50 minutes. If you drove at an average of 41 mph, how much distance you traveled?
Find the value of each variable in the parallelogram.lg + 4) 7.16- h65°g=h=
-Solve the system of equations – X – 8y = 49 and —x – 2y = 7 by combining theequations.
According to the model, how many marriage licenses were issued in 2006? Round your answer to the nearest hundred.
what is the range of this exponential function?1) all real numbers 2) { y | y > 0 }3) { y | y ≥ 0 }4) { y | y ≤ 0 }5) { y | y < 0 }
City park is a square piece of land with an area of 10,000 square yards.Write and solve an equation to find the perimeter of the park.
A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.
Which one of the following equations could describe the above graph?OA. Y=1.5^(x+2)-3OB. Y=2^x+6Oc. = y=(1/2)^x+6D. Y= 3^(x-1)