mjoanna mjoanna
  • 01-12-2016
  • Mathematics
contestada

X+4y=6 y=-x+3 solve each system of linear equations by substitution

Respuesta :

ivanzud
ivanzud ivanzud
  • 01-12-2016
Plug in one of the equations for y. x+4(-x+3)=6. Solve for x. Then plug in x into one of the equations to get y. x-4x+12=6. -3x=-6. x=2. y=-2+3=1. X=2 and y=1.
Answer Link

Otras preguntas

An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
a antonym for biosphere
Susan ........ (Run) to school because she was late.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Susan ........ (Run) to school because she was late.
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn