audreyrupnow audreyrupnow

01-09-2021
Mathematics

contestada

8 more than the product of 7 and a number t
Write an algebraic expression

Respuesta :

sossokadeoliveira sossokadeoliveira

01-09-2021

Answer:

7t + 8

Step-by-step explanation:

Answer Link

Otras preguntas

One component of the pension liability under both U.S. GAAP and IFRS is prior service cost (or past service cost under IFRS). ABC Company is trying to calculate

The daily dinner bills in a local restaurant are normally distributed with a mean of $28 and a standard deviation of $6. What is the probability that a randomly

In dual agency, conflicts of interest may arise since a single broker has both the listing contract with the seller and a buyer agency agreement with the purcha

Please help with the answer

PLEASE HELP FIRST ANSWER GETS BRAINLIEST!

A towns population increased from 14523 to 16489 what is the percent increase in the towns population

Bend Inc. holds 25% of the outstanding voting shares of Calico Co. and appropriately applies the equity method of accounting. Amortization associated with this

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Note: Enter your answer and show all the steps that you use to solve this problem in the space provided. What is the volume of the rectangular prism? A rectang

Why would a government put a restriction on the number of goods that can be imported into their country?