trinityburkes trinityburkes

01-03-2022
History

contestada

true or false new mexico was an original american colony.

Respuesta :

narstarolor narstarolor

01-03-2022

Answer:

False

Explanation:

New Mexico came from territories in the Mexican Cession, the Gadsden Purchase, and the Louisiana Purchase

the original colonies are

i need brainliest for level up please

Answer Link

Otras preguntas

Who was Vice President under JQ Adams and Jackson

A "home-made" solid propellant rocket has an initial mass of 9 kg; 6.8 kg of this is fuel. The rocket is directed vertically upward from rest, burns fuel at a c

What's the best way to learn Spanish

Assume that the market is perfectly competitive. If the cost function for John's Shoe Repair is �(�) = 100 + 10� − �) + 3 4 �4, what is the firm's marginal cost

What was the result of the Battle of the Fallen Timbers of 1794? American Indians were forced to

Presidential Republicans first emerge in ________ when the majority of Texans voted for______. A. 1960, Nixon B. 1952, Eisenhower C. 1952, Reagan

The Fifteenth Amendment was ratified in order to — *

heeeeeeeeeeeeeeeeeeeeeeeeeeelp

Godden and Baddeley found that if you study on land, you do better when tested on land, and if you study underwater, you do better when tested underwater. This

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA