linaresbentley linaresbentley
  • 04-04-2022
  • English
contestada

Why is this statement considered a theme and not a plot summary?
True friends will always be there for you when you need
them.

Respuesta :

Pa2k Pa2k
  • 04-04-2022
Because it doesn’t make a story it is a statement
Answer Link

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Do you think then solid can undergo convection
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which word has the long e sound? a. client b. inferior c. beautiful d. poetic
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what are the 2 major types of cofactors?
4.2meters= how many centimeter