caranewton44 caranewton44

02-04-2015
Physics

contestada

as the wavelength of A wave in a uniform medium increases, its speed will what?

Respuesta :

02-04-2015

The speed of a wave in a uniform medium doesn't depend on its wavelength.

Answer Link

Otras preguntas

Insulin is a protein that is used by the body to regulate both carbohydrate and fat metabolism. a bottle contains 425 ml of insulin at a concentration of 20.0 m

the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere

The somatosensory area is to the auditory area what the _____ lobe is to the _____ lobe

Explain the carbon cycle and explain why burning fossil fuels is an issue.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

circadian rhythm refers to

What is the value of c?

You can calculate triangle area when you know all three sides by using Heron's Formula. You can also use a formula discovered by the Chinese which I found in W

allied needs in world war 1 spurred the growth of what industry in Seattle, Tacoma, and Vancouver?A: commercial fishing B: shipbuilding C: textilesD: weapons de

As the mother of a late-maturing boy, betty is concerned because, when compared to early-maturing boys, late maturers are more likely to ________.