Iamsopretty4298 Iamsopretty4298

02-09-2017
History

contestada

Who were the “indians” that columbus met at san salvador?

Respuesta :

thert68 thert68

02-09-2017

The Taino were the 'indians' Columbus met in San Salvador.

Answer Link

Otras preguntas

help plz asap !!!!!!!!!!

Why might echinoderms make a more appropriate study species for making inferences about humans than other commonly studied species such as drosophila fruit flie

A train leaves new york at 4:00 pm. a second train leaves the same city in the same direction at 6:00 pm. the second train travels 60mph faster than the first.

(-5x^2)^3 plzzzz help

help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute

Why was the sinking of the Lusitania important? A. It highlighted British aggression towards neutral shipping. B. It kept the United States out of

Tick the option that shows how the words 'where my nan lives' are used in the sentence. On holiday, we drove through the village where my nan lives. 1)as a rela

a trip to the ocean can be a relaxing escape from the everyday pressures of life. A Sailboat glistening on the horizon provides a mental escape to faraway place

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

please help me if you can, thank you!