Asahi
Asahi Asahi
  • 03-11-2017
  • History
contestada

What are the disadvantages of being a member of third party

Respuesta :

LagMaster
LagMaster LagMaster
  • 03-11-2017
*One of the biggest disadvantages is that third parties cant be elected, so you would only join one to get your opinion across or prove a point. *Another is that its very hard to raise enough money  and *last not many people know about them they get little close to no advertisement
Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Which body tissue or organ contains the most mitochondria?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please answer theses division problems!! 9 divided by 3/7
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
Which word has the long i sound? relieve speciality society social
What kind of problems did increased urbanization cause? During time of industrial revolution
What was George Washington's nickname?