charlovepuppy20 charlovepuppy20
  • 02-01-2018
  • Mathematics
contestada

231 students went on a field trip 9 buses were filled and 15 students traveled in cars how many students were in each bus

Respuesta :

Hosein
Hosein Hosein
  • 02-01-2018

[tex]231 - 15 = 216 \\ 216 = 9x \\ x = 24[/tex]
Answer Link
Аноним Аноним
  • 02-01-2018
Answer: 216


I hope this helps and have a wonderful day filled with joy!!

<3
Answer Link

Otras preguntas

in what area of Europe were the majority of warsaw pact countries
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
who fought against each other in the crusades?
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Compliant is to stubborn as excited is to
the reproductive system of a male mammal provides
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.